Chromatin compartmentalization regulates the response to DNA injury

Cell tradition and coverings

DIvA (AsiSI-ER-U2OS)¹⁹, AID-DIvA (AID-AsiSI-ER-U2OS)²³ and 53BP1-GFP DIvA²⁰ cells had been developed in U2OS (ATCC HTB-96) cells and had been beforehand described. Authentication of the U2OS cell line was carried out by the supplier ATCC, which makes use of morphology and brief tandem repeat profiling to verify the identification of human cell strains. DIvA, AID-DIvA and 53BP1-GFP-DIvA cells derived from these U2OS cells weren’t additional authenticated. All the cell strains had been commonly examined for absence of mycoplasma contamination utilizing the MycoAlert Mycoplasma (Lonza). All the cell strains had been grown in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% SVF (Invitrogen), antibiotics and both 1 µg ml⁻¹ puromycin (DIvA cells) or 800 µg ml⁻¹ G418 (AID-DIvA and 53BP1-GFP AID-DIvA) at 37 °C below a humidified environment with 5% CO₂. To induce DSBs, U2OS cells had been handled with etoposide (Sigma-Aldrich, E1383) for 4 h at 500 nM and DIVA or AID-DIvA cells had been handled with 300 nM OHT (Sigma-Aldrich, H7904) for 4 h (supplementary desk 1 of ref. ⁵ for positions). For ATM or DNA-PK inhibition, cells had been respectively pretreated for 1 h with 20 μM KU-55933 (Sigma-Aldrich, SML1109) or 2 μM NU-7441 (Selleckchem, S2638) and through subsequent OHT remedy. For cell synchronization, cells had been incubated for 18 h with 2 mM thymidine (Sigma-Aldrich, T1895), then launched throughout 11 h, adopted by a second thymidine remedy for 18 h. S, G2 and G1 cells had been then respectively handled with OHT at 0, 6 or 11 h after thymidine launch and picked up 4 h later. siRNA and plasmid transfections had been carried out utilizing the 4D-Nucleofector package and the SE cell line 4D-Nucleofector X L or S package (Lonza) in accordance with the producer’s directions, and subsequent remedy(s) had been carried out 48 h later. siRNA transfections had been carried out utilizing a management siRNA (siCtrl): CAUGUCAUGUGUCACAUCU; or siRNA concentrating on SCC1 (siSCC1): GGUGAAAAUGGCAUUACGG; SMC1 (siSMC1): UAGGCUUCCUGGAGGUCACAUUUAA; 53BP1 (si53BP1): GAACGAGGAGACGGUAAUA; SUN2 (siSUN2): CGAGCCTATTCAGACGTTTCA; ARP2 (siARP2): GGCACCGGGUUUGUGAAGU; SETX (siSETX): GAGAGAAUUAUUGCGUACU; and RNASEH1 (siRNASEH1)⁴⁸: CUGUCUUGCUGCCUGUACU. pICE-NLS-mCherry (known as pICE-empty within the textual content; Addgene plasmid, 60364) and pICE-RNase-H1-WT-NLS-mCherry (known as pICE-RNase-H1 within the textual content, Addgene plasmid, 60365) had been respectively used as management and for RNase H1 over-expression (presents from P. Calsou and S. Britton).

Illegitimate rejoining assay

Illegitimate rejoining assays after siRNA transfection had been carried out no less than in triplicate in AID-DIvA cells as described beforehand³⁸. Illegitimate rejoining assays in synchronized cells had been carried out in DIvA cells after an OHT remedy (n = 4 organic replicates). The genomic DNA was extracted from 1–5 × 10⁶ cells utilizing the DNeasy Blood & Tissue Equipment (Qiagen), in accordance with the producer directions. Two totally different illegitimate rejoinings between totally different AsiSI websites had been assessed by qPCR utilizing the next primers: 1Fw, GACTGGCATAAGCGTCTTCG and 1Rev, TCTGAAGTCTGCGCTTTCCA; and 2Fw, GGAAGCCGCCCAGAATAAGA and 2Rev, TCCATCTGTCCCTATCCCCAA. The outcomes had been normalized utilizing two management areas, each removed from any AsiSI websites and γH2AX domains utilizing the next primers: Ctrl_chr1_82844750_Fw, AGCACATGGGATTTTGCAGG and Ctrl_chr1_82844992_Rev, TTCCCTCCTTTGTGTCACCA; and Ctrl_chr17_9784962_Fw, ACAGTGGGAGACAGAAGAGC and Ctrl_chr17_9785135_Rev, CTCCATCATCGCACCCTTTG. Normalized illegitimate rejoining frequencies had been calculated utilizing Bio-Rad CFX Supervisor v.3.1.

RT–qPCR

RNA was extracted from contemporary DIvA cells earlier than and after DSB induction utilizing the RNeasy package (Qiagen). RNA was then reverse transcribed to cDNA utilizing AMV reverse transcriptase (Promega, M510F). qPCR experiments had been carried out to evaluate the degrees of cDNA utilizing primers concentrating on RPLP0 (FW, GGCGACCTGGAAGTCCAACT; REV, CCATCAGCACCACAGCCTTC), RNF19B (FW, CATCAAGCCATGCCCACGAT; REV, GAATGTACAGCCAGAGGGGC), PLK3 (FW, GCCTGCCGCCGGTTT; REV, GTCTGACGTCGGTAGCCCG), GADD45A (FW, ACGATCACTGTCGGGGTGTA; REV, CCACATCTCTGTCGTCGTCC). PPM1D (FW, CTTGTGAATCGAGCATTGGG; REV, AGAACATGGGGAAGGAGTCA), SLC9A1 (FW, TGTTCCTCAGGATTTTGCGG; REV, ATGAAGCAGGCCATCGAGC), LPHN2 (FW, CGATTTGAAGCAACGTGGGA; REV, TGATACTGGTTGGGGAAGGG), UTP18 (FW, TCCTACTGTTGCTCGGATCTC; REV, ATGAAGCAGGCCATCGAGC), IPO9 (FW, CACAGATGCCACTTGTTGCT; REV, TGCTGTACCACGGGAAAGAT) or PARP1 (FW, ATTCTGGACTGGAACACTCTGC; REV, CTGTTCCAGTTTGTTGCTACCG). cDNA ranges had been then normalized to RPLP0, then expressed as the proportion of the undamaged situation.

Immunofluorescence

DIvA cells had been grown on glass coverslips and stuck with 4% paraformaldehyde throughout 15 min at room temperature. A permeabilization step was carried out by treating cells with 0.5% Triton X-100 in PBS for 10 min, then cells had been blocked with PBS-BSA 3% for 30 min. Main antibodies towards γH2AX (JBW301, Millipore Sigma, 05-636) had been diluted 1:1,000 in PBS-BSA 3% and incubated with cells in a single day at 4 °C. After washes in 1× PBS, cells had been incubated with anti-mouse secondary antibodies (conjugated to Alexa 594 or Alexa 488, Invitrogen), diluted 1:1000 in PBS-BSA 3%, for 1 h at room temperature. After staining with DAPI, Citifluor (Citifluor, AF-1) was used for coverslip mounting. Photographs had been acquired with the software program MetaMorph, utilizing the ×100 goal of a wide-field microscope (Leica, DM6000) outfitted with a digital camera (DR-328G-C01-SIL-505, ANDOR Know-how). The spatial evaluation (Ripley operate) of γH2AX spot distribution was carried out as described beforehand²⁰ utilizing the spot detector plug-in in Icy.

Excessive-content microscopy

Transfected DIvA and U2OS cells had been plated in 96-well Cell Service plates (Perkin Elmer). Cells had been subjected to OHT or etoposide therapies and an immunofluorescence as described above utilizing anti-mouse Alexa 488 secondary antibodies (Invitrogen) for γH2AX detection. Cells had been stained with 5 µg ml⁻¹ Hoechst 33342 (Invitrogen) for 30 min at room temperature. γH2AX foci had been analysed utilizing the Operetta CLS Excessive-Content material Imaging System (Perkin Elmer) and Concord software program (v.4.9). For quantitative picture evaluation, 81 fields per properly had been acquired with a ×40 goal lens to visualise round 4,000 cells per properly in triplicate. Subsequent analyses had been carried out with Columbus software program (v.2.8.2). Dedication of the quantity (y axis) and dimension of γH2AX foci (imply space on the x axis) in every nucleus was been used to deduce clustering (clustering results in a low variety of giant foci) (>8,000 nuclei analysed per pattern). Scatter plots are divided into 4 quadrants on the idea of the median quantity and dimension of foci and the odds of cell populations which are cluster optimistic (backside proper quadrant) or cluster detrimental (high left quadrant) are decided.

3D RIM super-resolution acquisition and reconstruction

3D + t dwell RIM was carried out on AID-DIvA cells expressing 53BP1–GFP²⁰ utilizing an improve of the system and technique described beforehand⁴⁹. In short, 60 3D photographs had been acquired throughout 47 min utilizing an inverted microscope (TEi Nikon) outfitted with a ×100 magnification, 1.49 NA goal (CFI SR APO 100XH ON 1.49 NIKON) and SCMOS digital camera (ORCA-Fusion, Hamamatsu). The temporal decision of all the Supplementary Movies is 40 s. A industrial acquisition software program (INSCOPER SA) permits a whole-cell single-timepoint 3DRIM acquisition in solely 6 s below a low-photobleaching regime (1 W cm⁻²). Quick diode lasers (Oxxius) with the wavelengths centred at 488 nm (LBX-488-200-CSB) had been used to provide a TEM00 2.2-mm-diameter beam. The polarization beam was rotated with an angle of 5° earlier than hitting a X4 Beam Expander beam (GBE04-A) and produced a 8.8 mm TEM00 beam. A quick spatial mild part binary modulator (QXGA fourth dimensions) was conjugated to the picture airplane to create 48 random illumination by every airplane as described beforehand⁴⁹. 3D picture reconstruction was then carried out as described beforehand⁴⁹ and at GitHub (https://github.com/teamRIM/tutoRIM).

3D movie enhancing

Bleaching correction was carried out after RIM reconstruction utilizing open-source FIJI software program (https://imagej.web/software program/fiji/) primarily based on exponential FIT from the background sign. The 3D drift correction FIJI plugin was carried out for 3D registration (https://github.com/fiji/Correct_3D_Drift). 3D + t video rendering was generated utilizing the VTK library applied in ICY software program (https://icy.bioimageanalysis.org/) from a 3D crop of the realm of curiosity.

FRAP measurements

FRAP experiments had been carried out on 53BP1–GFP foci utilizing a Zeiss LSM 710 confocal mild scanning microscope (Carl Zeiss) outfitted with a ×63/1.2 NA oil-immersion goal. Sometimes, photographs had been acquired at 512 × 256 px at a scan velocity akin to 200 ms per picture, and 300 photographs had been acquired over 2 min, with an interval of 500 ms between subsequent photographs. Earlier than photobleaching half of the foci, three photographs had been recorded.

For every experiment, a customized R script was used to phase the picture, monitor the bleached foci and retrieve the common depth of the bleached half (I_B), the non-bleached half (I_NB), the background (I_BG), and the remainder of the nucleus (I_REF) at every body. These depth values had been used to calculate FRAP curves for the bleached half (FRAP_B) and the non-bleached half (FRAP_NB), in accordance with ref. ²⁴:

Right here, A represents undesirable bleaching within the non-bleached half. FRAP_B and FRAP_NB had been multiplied by the scale of their respective areas of curiosity (ROIs) (N_B and N_NB, respectively) to acquire curves which are proportional to the variety of particles in every half

The curves had been then normalized with respect to the variety of bleached molecules:

Right here, t_pre and t_bleach are the acquisition occasions of the final body earlier than the bleach and the primary body after the bleach, respectively. The ensuing FRAP curves are proportional to the ROI sizes and double-normalized. Lastly, an additive offset was utilized to the sign within the non-bleached half to normalize to unity earlier than the bleach.

The ensuing curves replicate the change within the variety of labelled molecules in every half. Within the presence of an motionless fraction of molecules that don’t transfer through the course of the experiment as a result of they tightly bind to motionless binding websites, the sign in each halves won’t get better to the identical stage, however there can be an offset between them that corresponds to the motionless fraction X_motionless. To right for these motionless molecules, the FRAP curves are modified in accordance with:

Lastly, to find out the presence or absence of an interfacial barrier within the foci, the curves had been in comparison with half-FRAP experiments carried out in an answer of freely diffusing poly-lysine-fluorescein (0.1 mg ml⁻¹) and to half-FRAP experiments of 53BP1-GFP molecules diffusing within the nucleoplasm (adjoining to foci). On this case, the utmost lower in normalized fluorescence all the way down to a price of 0.90 ± 0.03 signifies the absence of a barrier (horizontal black strains in Fig. 2f,g) whereas bigger decreases point out the presence of an interfacial barrier.

DNA injury induction by laser irradiation

DIvA cells had been transfected with a plasmid encoding the macrodomain of macroH2A1.1 fused to mKate2 (macro–mKate2)⁵⁰ and handled with OHT for 4 h. For microirradiation, a round spot with a radius of 1 µm was chosen within the nucleoplasm the place 53BP1–GFP foci had been absent. Then, steady illumination with a 405 nm laser at most energy was utilized for 1 min. The recruitment of 53BP1–GFP and macro–mKate2 was noticed through the subsequent 10 min. Half-FRAP experiments at these laser-induced 53BP1–GFP foci had been carried out as described above after 5 min of their formation.

53BP1 focus fusion quantification

Fusion occasions had been chosen from the 3D photographs acquired by RIM. In the course of the fusion, the foci had been segmented and the normalized side ratio, or eccentricity, was calculated as AR_norm = (R_max − R_min)/(R_max + R_min), the place R_max and R_min are the longest and shortest radius, respectively. The normalized side ratio over time was then fitted with an exponential operate with an additive offset to acquire the relief fixed (t_R) and the side ratio of the tip product after fusion. t_R values obtained from 5 totally different experiments had been plotted versus the scale of the respective foci after the fusion and fitted with a linear operate, the slope of which is the inverse capillary velocity.

RNAscope

RNAscope permits the visualization of transcription websites^51,52. DIvA cells had been grown on Chambered Cell Tradition Slides (Corning Falcon, 08-774-25) and stuck with 4% paraformaldehyde throughout 15 min at room temperature. The RNAscope assay was carried out utilizing the RNAscope Multiplex Fluorescent Equipment v2 package (ACDBio, 323100) in accordance with the producer’s directions. In short, fastened cells had been pretreated with RNAscope Hydrogen Peroxide for 10 min, then permeabilized with RNAscope Protease III (1:15 diluted) for 10 min. Cells had been then incubated with the probes RNAscope Probe-Hs-GADD45A-C1 (ACDBio, 477511) and RNAscope Probe-Hs-CCL2-C2 (ACDBio, 423811-C2) or RNAscope Constructive Management Probe-Hs-PPIB-C2 (ACDBio, 313901-C2), or with the intronic probes RNAscope Probe-Hs-PLK3-intron-C1 (ACDBio #1263411) and RNAscope Probe-Hs-CDC42-intron-C2 (ACDBio, 1263101) or RNAscope Probe-Hs-ADGRL2-intron-C2 (ACDBio, 1263111) in a HybEZTM Oven at 40 °C for two h. Sign-amplification steps had been carried out, adopted by the event of the HRP-C1 and HRP-C2 indicators, utilizing Opal dye 620 and 690 (Akoya Biosciences) diluted to 1:750. Lastly, immunofluorescence was carried out as described above, with out a further permeabilization step and utilizing γH2AX (JBW301, Millipore) and DAPI staining. Photographs had been acquired with the software program Micro-Supervisor, utilizing the ×40 or ×60 goal of a spinning-disk/high-speed widefield CSU-W1 microscope, outfitted with an Andor Zyla sCMOS digital camera. The colocalization between γH2AX foci and RNA foci was measured utilizing Cell Profiler. Two foci had been thought of to be colocalizing when a part of their areas was overlapping and if their respective centroids had been separated by lower than 1 μm.

Western blot

AID-DIvA cells had been incubated in RIPA buffer (50 mM Tris at pH 8, 150 mM NaCl, 0.5% deoxycholate, 1% NP-40, 0.1% SDS) on ice for 20 min and centrifuged at 13,000 rpm for 10 min. The supernatant, containing soluble protein extracts, was then combined with SDS loading buffer and lowering agent, resolved on 3–8% NuPAGE Tris-acetate gels (Invitrogen) and transferred onto PVDF membranes (Invitrogen) in accordance with the producer’s directions. For RNase H1 expression, 0.5 × 10⁶ DIvA cells had been incubated 15 min at room temperature with 625 U of GENIUS Nuclease (Santa Cruz Biotechnology, sc-202391) in SDS loading buffer. After including a lowering agent, the samples had been heated at 95 °C for five min and loaded onto a NuPAGE 4–12% Bis-Tris gel in MOPS SDS operating buffer and transferred onto a PVDF membrane (Invitrogen) with the Trans-Blot Turbo Switch System in accordance with the producer’s directions (Bio-Rad). PVDF membranes had been incubated in TBS containing 0.1% Tween-20 (Sigma-Aldrich, P1379) and three% non-fat dry milk for 1 h for blocking, adopted by in a single day incubation at 4 °C utilizing major antibodies concentrating on SUN2 (Abcam, ab124916, 1:1,000), ARP2 (Abcam, ab128934, 1:1,000), 53BP1 (Novus Biologicals, NB100-305, 1:1,000), RNase H1 (Invitrogen, PA5-30974, 1:1,000), SCC1 (Abcam, ab992, 1:500), SMC1 (Abcam, ab75819, 1:1,000), myosin I-β (Sigma-Aldrich, M3567, 1:1,000), GAPDH (Sigma-Aldrich, MAB374, 1:10,000) or α-tubulin (Sigma-Aldrich, T6199, 1:10,000). The corresponding mouse or rabbit horseradish-peroxidase-coupled secondary antibodies had been used at 1:10,000 to disclose the proteins (Sigma-Aldrich, A2554 and A0545), utilizing a luminol-based enhanced chemiluminescence HRP substrate (Tremendous Sign West Dura Prolonged Period Substrate, Thermo Fisher Scientific). Image acquisition of the membranes was carried out utilizing the ChemiDoc Contact Imaging System and footage had been visualized utilizing Picture Lab Contact software program.

RNA-seq

RNA-seq in DIvA cells was carried out as described beforehand³⁸. Uncooked sequencing knowledge had been mapped in paired-end to a customized human genome (hg19 merged with ERCC92) utilizing STAR. Depend matrices had been extracted utilizing htseq-count with union as resolution-mode and reverse-strand mode. Differential expression evaluation was carried out on the rely matrix utilizing edgeR with two replicates per situation (with or with out 4 h OHT remedy) and differential genes had been decided utilizing log-ratio check. Entire-genome protection was computed utilizing the bamCoverage command type deeptools to generate bigwig from BAM information (with out PCR duplicate suppression). Differential protection between two circumstances was carried out utilizing BamCompare from deeptools with setting the binsize parameter at 50 bp. The log₂-transformed fold change was calculated utilizing edgeR in differential expression evaluation. Utilizing a cut-off adjusted P worth of 0.1 and a log₂-transformed fold change of 0.5 (~41% enhance/lower of expression), we had been in a position to decide 286 upregulated and 125 downregulated genes with 11 of them straight broken by a DSB. On chromosomes 1, X and 17, n = 35 genes had been discovered to be upregulated and n = 1,839 not regulated (Fig. 3d). On chromosomes 1, 2, 6, 9, 13, 17, 18, 20 and X, n = 86 genes had been discovered upregulated and n = 3,829 not upregulated (Prolonged Information Fig. 5g). For additional classification within the D and non-D compartment, to analyse sufficient genes, the cut-off for upregulation was set at a log₂-transformed fold change of 0.3 (see beneath).

qDRIP–seq

qDRIP–seq was tailored from a earlier research³⁹. In short, 2.5 × 10⁶ of trypsinized DIvA cells had been combined with 1.67 × 10⁶ Drosophila S2 cells and lysed in a single day at 37 °C in TE buffer containing 0.5% SDS and 800 µg proteinase Okay (Roche, 03115828001). DNA was extracted by phenol–chloroform extraction utilizing phase-lock tubes (Qiagen, MaxTract, 129065) adopted by ethanol precipitation. DNA was resuspended on ice in 130 µl TE buffer earlier than sonication within the Covaris S220 system (microtubes, PN520045) to acquire ~300 bp DNA fragments (Covaris S220, 140 W peak incident energy, 10% responsibility issue, 200 cycles per burst for 80 s). Immunoprecipitation was carried out in triplicate by incubating 4 µg of sonicated DNA with 10 µg of S9.6 antibody (Antibodies Incorporation) in 1× binding buffer (10 mM NaPO₄, 140 mM NaCl, 0.05% Triton X-100) in a single day and at 4 °C. Agarose A/G beads (Thermo Fisher Scientific, 20421) had been added to samples for two h at 4 °C. Beads had been washed 4 occasions in binding buffer adopted by incubation with elution buffer (50 mM Tris pH 8, 10 mM EDTA, 0.5% SDS, 0.3 µg µl⁻¹ proteinase Okay) for 45 min at 55 °C. The samples had been subjected to phenol–chloroform extraction and ethanol precipitation, and had been resuspended in low EDTA TE. Sequencing libraries had been ready utilizing the Swift ACELL-NGS 1S Plus package in accordance with the producer’s directions utilizing 12 PCR cycles. Libraries had been pooled at equimolar concentrations and sequenced utilizing the Illumina NextSeq 500 system with 75 paired-end reads.

qDRIP–seq knowledge had been processed utilizing a customized pipeline taking into consideration stranded and spike-in library preparation. In short, reads had been trimmed utilizing Trimmomatic (v.0.39)⁵³ to take away remaining primers from the library. BWA-MEM was used for mapping reads to a customized reference genome merging hg19 and dm6 (spike-in) chromosomes. Samtools was used to generate BAM information with reads primarily based on their mapping location (hg19 or dm6). Strand-specific knowledge had been generated utilizing Samtools view and merge with flags filters: 80;160 for reverse fragments, and 96;144 for ahead fragments. BAM information had been then sorted, listed and duplicates had been eliminated. Bigwig information had been generated on these knowledge, normalized to whole learn counts (counts per million) or by the quantity or reads mapped on dm6 (spike-in). Differential protection between two circumstances was carried out utilizing BigWigCompare from deeptools with the substract setting⁵⁴ and with setting bin dimension parameter at 50 bp. Slender peaks had been detected utilizing macs3 callpeak algorithm⁵⁵ on qDRIP bams utilizing -q 0.1, and by taking solely good high quality peaks with a rating (fold-change at peak summit) no less than superior to 100.

DRIP–qPCR

DRIP–qPCR was carried out as described beforehand³⁸ utilizing primers for RPL13A (FW, AATGTGGCATTTCCTTCTCG; REV, CCAATTCGGCCAAGACTCTA) and PLK3 (FW, CGGAGCAGAGGAAGAAGTGA; REV, CATGCATGAACAGCCCATCA).

Amplicon–seq

AID-DIvA cells had been handled with or with out 300 nM OHT for 4 h adopted by remedy with indole-3-acetic acid for 14 h to degrade AsiSI²³. The genomic DNA was extracted from 5 × 10⁶ cells utilizing the DNeasy Blood & Tissue Equipment (Qiagen) in accordance with the producer’s directions. Genomic DNA was then utilized in a multiplex PCR response that amplified 25 goal websites: 20 AsiSI minimize websites and 5 uncut management websites (Prolonged Information Desk 1). Amplicons had been size-selected utilizing SPRIselect beads (Beckman, B23318) and processed for DNA library preparation utilizing the NEBNext Extremely II package (NEB, E7645L). Libraries had been pooled at equimolar concentrations and sequenced utilizing the Illumina NextSeq 500 system with paired-end 150 cycles. The information had been analysed utilizing our customized software mProfile, obtainable at GitHub (https://github.com/aldob/mProfile). This recognized the genomic primers used within the unique genomic PCR response to amplify every learn within the pair. Translocated reads had been due to this fact recognized as these the place every learn in a pair was amplified by a special primer set, and this was normalized to the entire reads that had been accurately amplified by these primer units. The warmth map of illegitimate rejoining/translocation occasions was made between 20 DSBs by computing the ratio between the +DSB and −DSB pattern for every pair of DSBs and evaluating the log₂-transformed ratio distribution between every situation and management. Significance was computed utilizing nonparametric Wilcoxon assessments.

4C-seq

4C-seq experiments carried out in synchronized cells, earlier than and after DSB induction, had been carried out as described beforehand⁷. In short, 10–15 × 10⁶ DIvA cells per situation had been cross-linked, lysed and digested with MboI (New England Biolabs). DNA ligation was carried out utilizing the T4 DNA ligase (HC) (Promega), and ligated DNA was digested once more utilizing NlaIII (New England Biolabs). Digested DNA was religated with the T4 DNA ligase (HC) (Promega) earlier than continuing to 4C-seq library preparation. A complete of 16 particular person PCR reactions was carried out to amplify round 800 ng of 4C-seq template, utilizing inverse primers together with the Illumina adaptor sequences and a novel index for every situation (Prolonged Information Desk 2). Libraries had been pooled and despatched to a NextSeq 500 platform on the I2BC Subsequent Technology Sequencing Core Facility (Gif-sur-Yvette).

4C-seq knowledge had been processed as described beforehand⁷. In short, BWA-MEM was used for mapping and Samtools was used for sorting and indexing. A customized R script (https://github.com/bbcf/bbcfutils/blob/grasp/R/smoothData.R) was used to construct the protection file in bedGraph format, to normalize utilizing the common protection and to exclude the closest area from every viewpoint. Differential 4C-seq knowledge had been computed utilizing BamCompare from deeptools with binsize=50 bp. The common of whole trans interactions between viewpoints and DSBs was then computed utilizing a 1 Mb window across the breaks (80 greatest) and after exclusion of viewpoint–viewpoint (cis) interactions.

Hello-C

Hello-C knowledge obtained earlier than and after DSB induction and after management or SCC1 depletion in DIvA cells had been retrieved from a earlier research⁷. Hello-C experiments with or with out DSB induction and after ATM or DNA-PK inhibition, or after transfection with management or SETX siRNAs had been carried out in DIvA cells as described beforehand⁷. In short, 10⁶ cells had been used per situation. Hello-C libraries had been generated utilizing the Arima Hello-C package (Arima Genomics) in accordance with the producer’s directions. DNA was sheared to a median fragment dimension of 350–400 bp utilizing the Covaris S220 system and sequencing libraries had been ready on beads utilizing the NEB Subsequent Extremely II DNA Library Prep Equipment for Illumina and NEBNext Multiplex Oligos for Illumina (New England Biolabs) in accordance with the directions of the Arima Hello-C package.

Hello-C knowledge analyses

Hello-C warmth maps

Hello-C reads had been mapped to the hg19 genome and processed utilizing Juicer with the default settings (https://github.com/aidenlab/juicer). Hello-C rely matrices had been generated utilizing Juicer at a number of resolutions: 100 kb, 50 kb, 25 kb, 10 kb and 5 kb. Hello-C warmth map screenshots had been generated utilizing Juicebox (https://github.com/aidenlab/Juicebox/wiki/Obtain). Mixture warmth maps had been computed on a set of submatrices extracted from the initially noticed Hello-C matrices at 50 kb decision or 100 kb decision. The area of 5 Mb round DSBs (80 greatest) was extracted after which averaged. The log₂-transformed ratio was then computed utilizing Hello-C counts (+DSB/−DSB) and plotted as warmth maps.

Cis contact quantification

For cis contact quantification, interactions inside γH2AX domains (−0.5/+0.5 Mb across the 80 greatest DSBs) had been extracted from the noticed Hello-C matrix at 100 kb decision, and the log₂-transformed ratio was computed on broken versus undamaged Hello-C counts (+DSB/−DSB). Adjoining home windows (−1.5 Mb–0.5 Mb and +0.5 Mb–1.5 Mb round 80 greatest DSBs) had been retrieved to quantify interactions between broken domains and adjoining undamaged domains.

Trans contact quantification

To find out interplay adjustments in trans (interchromosomal), we constructed the whole-genome Hello-C matrix for every experiment by merging collectively all chromosome–chromosome interplay matrices utilizing Juicer and R. The result’s a genome matrix with 33,000 × 33,000 bin interactions for 100 kb decision. Interactions between bins inside broken TADs (240 × 240 for 80 DSBs) had been extracted and counted for every situation, the log₂-transformed ratio was calculated on normalized counts (counts per million), and plotted as field plots or warmth maps. For the field plots, the centre line exhibits the median; the field limits present the primary and third quartiles; the whiskers present the utmost and minimal values with out outliers; and the factors present the outliers. For the warmth maps, every tile corresponds to log₂[+DSB/−DSB] between DSB (100 kb bins inside ±1 Mb areas had been averaged). They had been additional sorted on the idea of the 53BP1 ChIP–seq stage (Prolonged Information Fig. 7f), in accordance with beforehand decided homologous-recombination-prone and non-homologous-end-joining-prone DSBs⁵ (Prolonged Information Fig. 2nd), or to the extent of PC1 decided by making use of PCA in Hello-C DIvA to determine A/B compartments (Prolonged Information Fig. 4d).

APA on endogenous breaks

Endogenous breaks had been recognized by calling peaks on pATM ChIP–seq knowledge with out OHT remedy⁷ utilizing macs2 with -q 0.01, giving 1,206 slim peaks. Of those peaks, solely interchromosomal pairs (trans) had been retained utilizing a BEDPE format file. Random positions had been generated utilizing the gkmsvm bundle and pairs of interactions had been constructed in accordance with the identical process. APA was then carried out on these trans pairs utilizing juicertools.

TAD cliques

TAD cliques had been computed utilizing the igraph R bundle on an undirected graph representing DSB clustering. This graph was computed on the differential Hello-C matrix (+DSB/−DSB) counts, at 500 kb decision, contemplating a change of round 86% of interplay (0.9 in log₂) between two DSBs as a node on the graph. Averaged ChIP–seq sign values (53BP1/γH2AX/H1/Ubiquitin FK2) had been then computed for every class of cliques utilizing 500 kb home windows round DSBs. For prior RNA polymerase II occupancy, the sign was computed on 10 kb round DSBs.

A/B compartment

To determine the 2 mains chromosomal compartments (A/B), the extraction of the primary eigenvector of the correlation matrix (PC1) was carried out on the noticed/anticipated matrix at 500 kb decision utilizing the juicer eigenvector command. The ensuing values had been then correlated with the ATAC-seq sign to attribute optimistic and detrimental values to the A and B compartment, respectively, on every chromosome. The noticed/anticipated bins had been organized on the idea of the PC1 values and aggregated into 21 percentiles, to visualise A–B interactions on our experiments (saddle plots).

D compartment

To determine the D compartment, we retrieved the primary element (PC1) of a PCA made on the differential noticed Hello-C matrix ({log }_{2}left(frac{{rm{broken}}}{{rm{undamaged}}}proper)) at 100 kb decision. Every matrix was extracted from the .hic information utilizing Juicer and the ratio was computed bin per bin. Pearson correlation matrices had been then computed for every chromosome and PCA was utilized on every matrix. The primary element of every PCA was then extracted and correlated with the positions of DSB. A PC1 displaying a optimistic correlation with DSB was then known as the D compartment and PC1 displaying a detrimental correlation with DSBs had been multiplied by −1. We had been in a position to extract the D compartment on chromosomes 1, 17 and X for +DSB/−DSB and chromosomes 1, 2, 6, 9, 13, 17, 18, 20 and X for +DSB/−DSB within the DNA-PKi situation. The D compartment (first element of the PCA) was transformed right into a protection file utilizing the rtracklayer R bundle. Utilizing the identical bundle, D compartment worth had been computed round DSBs and genes at 100 kb decision.

Dedication of D genes

First, all genes embedded in γH2AX domains (that’s, −1 Mb/+1 Mb across the 80 DSBs) had been faraway from the gene set. Underneath regular circumstances (with out DNA-PKi), on chromosomes 1, 17 and X, n = 493 genes displaying a optimistic PC1 worth on their total size in every of the three Hello-C replicates experiments had been recognized as ‘genes in compartment D’ genes, whereas n = 346 genes displaying a detrimental worth in every of the three Hello-C replicates experiments had been labelled as ‘genes not in compartment D’. Within the presence of DNA-PKi, the place the D compartment was recognized on chromosomes 1, 2, 6, 9, 13, 17, 18, 20 and X, n = 2,161 had been present in compartment D, whereas n = 2,112 weren’t. The genes had been additional categorized in accordance with their upregulation after DSB induction (fold change > 0.3, unexpressed genes filtered), giving 4 classes. With out DNA-PKi, upregulated/compartment D (n = 40); upregulated/no compartment D (n = 32); downregulated and never regulated/compartment D (n = 453); downregulated and never regulated/no compartment D (n = 314).

Transcription issue motif evaluation

Transcription-factor-binding motifs had been extracted on the promoter areas (−500 bp of the transcription begin website (TSS)) of genes with optimistic worth of D compartment (2,161) versus genes with detrimental worth (2,112) recognized on chromosomes 1, 2, 6, 9, 13, 17, 18, 20 and X from the PCA evaluation of Hello-C (+DSB + DNA-PKi/−DSB) utilizing motifmatchr and TFBSTools R packages on the JASPAR2020 database. Motifs had been sorted by significance utilizing Fisher’s actual check and adjusted utilizing the Benjamini–Hochberg process between motifs discovered on gene contained in the D compartment versus genes exterior D compartment.

Correlation with DRIP–seq or qDRIP datasets

To evaluate a correlation between R-loop accrual and D-compartment formation, R-loop ranges obtained from DRIP–seq experiments carried out in DIvA cells³⁸ had been computed on prolonged gene our bodies (±2 kb TTS) and plotted as a field plot for classes (Figs. 3f and  4c). Conversely, to determine whether or not R-loop enriched genes, show increased ranges of differential CEV (D compartment) sign (Prolonged Information Fig. 6c), R-loop ranges had been computed on all genes of chromosome 1, 17 and X (±1 kb of the TTS) and additional categorized into 10 teams (primarily based on percentiles). The D-compartment sign was in contrast between the very best (n = 180) and lowest (n = 190) teams.

For qDRIP experiments, provided that the sign accumulates on slim peaks inside genes (in distinction to DRIP–seq), we used the recognized places of slim peaks (see the ‘qDRIP–seq’ part) contained in the genes in every class (±2 kb of the TTS) (Fig. 3h). We had been in a position to determine 83 peaks on upregulated D genes, 313 peaks on not upregulated D genes, 30 peaks on upregulated non-D genes and 457 peaks on not-upregulated non-D genes.

Correlation with SETX ChIP-seq knowledge

ChIP-seq SETX knowledge in DIvA cells had been from a earlier research³⁸. To evaluate SETX accruals at R-loops, BigWig protection information had been used to get SETX ChIP-seq protection on gene our bodies (±2 kb of the TTS) that overlap with qDRIP peaks (see above) (Fig. 3j).

Translocation breakpoints

For translocation breakpoints, knowledge from a earlier research⁴² had been retrieved, and solely breakpoints for interchromosomal structural variants had been chosen (n = 28,051). Genes reproducibly enriched within the D compartment within the three organic replicates, on chromosomes 1, 17 and X in addition to genes not enriched within the D compartment had been retrieved. The importance of the overlap between genes and breakpoints was decided utilizing the regioneR bundle⁵⁶ through the use of resampling check with PermTest. In short, we chosen 1,000 occasions a management set of genes, with the identical dimension and on the identical chromosome as our unique gene set. We examined the overlap between every gene and breakpoints to find out a distribution of the variety of overlaps between management set and breakpoints. We additional examined whether or not the overlap between our gene set (D compartment or non-D compartment) and breakpoints was important by counting the variety of occasions extra overlaps occurred within the management set than in our gene set.

GenomicRanges, plyranges, tidyverse, patchwork, ggforce, ggside and ggtext had been used to learn, manipulate and visualize genomic knowledge in R and produce figures. Bedtools was used to control genomic location and produce mattress or bigwig information. Built-in Genome Browser was used to visualise mattress and bigwig information. All the field plots present the median (centre line), first and third quartiles (field limits), most and minimal with out outliers (whiskers) and outliers (factors).

Reporting abstract

Additional data on analysis design is out there within the Nature Portfolio Reporting Abstract linked to this text.